RNAscope:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
Hybridization:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
DNA Fragmentation Assay:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
Fluorescence:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
Fat:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
cDNA Synthesis:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
Real-time Polymerase Chain Reaction:Article Title: Cell fate analysis of zone 3 hepatocytes in liver injury and tumorigenesis
Article Snippet: Sandgren, University of WisconsinMadison C57BL/6J male 46-week 11 Mus Musculus WT (DEN) CLEA Japan C57BL/6J male 35-week 9 1.4 Sequence based reagents Name Sequence Supplier Axin2, forward 5' - AACCTATGCCCGTTTCCTCTA - 3' Eurofins Axin2, reverse 5' - GAGTGTAAAGACTTGGTCCACC - 3' Eurofins GAPDH, forward 5' - TTGATGGCAACAATCTCCAC - 3’ Eurofins GAPDH, reverse 5’ - CGTCCCGTAGACAAAATGGT - 3’ Eurofins Created : November, 2018 1.5 Biological samples Description Source Identifier N/A 1.6 Deposited data Name of repository Identifier Link N/A 1.7 Software Software name Manufacturer Version Adobe Illustrator Adobe 25.2.1 Adobe Photoshop Adobe 22.3.0 EndNote Clarivate Analytics GraphPad Prism8 GraphPad Software Ver.8.4.0 Leica Application Suite X Leica Microsystems 3.6.0.20104 DP2-BSW Olympus 2.2 Word 2016 Microsoft 16.0.4266.1001 1.8 Other (e.g. drugs, proteins, vectors etc.) .. Tamoxifen Sigma-Aldrich T5648-5G Diethylnitrosoamine Sigma-Aldrich N0258-1G Corn oil Wako 032-17016 Ethanol (99.5) Wako 057-00456 LGK974 Selleck Chemicals S7143 Dimethyl Sulfoxide Wako 043-07216 0.5w/v% Methyl Cellulose 400 Solution, Sterilized Wako 131-17811 Target Retrieval Solution Jackson Immuno Research 017-000-121 Nomal Donkey Serum Jackson Immuno Research 017-000-121 Nomal Goat Serum Jackson Immuno Research 005-000-121 RNAscope 2.5 HD Detection Reagent - RED Advanved Cell Diagnostics 322360 RNAscope H2O2 & Protease Plus Reagents Advanved Cell Diagnostics 322330 Wash Buffer Reagents Advanved Cell Diagnostics 310091 Target Retrieval Reagents Advanved Cell Diagnostics 322000 RNAscope® Probe- MmAxin2 Advanved Cell Diagnostics 400331 HybEZTM Hybridization System With EZ-Batch Slide System Advanved Cell Diagnostics 321461 Streptavidin HRP BD Pharmingen 554066 DAB Peroxidase substrate Kit Vector Laboratories SK-4100 ApoAlert DNA Fragmentation Assay Kit Clontech 630107 Dako Fluorescence Mounting Medium Dako S3023 Mount-Quick Daido Sangyo DM-01 Created : November, 2018 Rodent Diet With 60 kcal% Fat Research Diets D12492 L-Amino Acid Diet With 60 kcal% Fat With 0.1% Methionine and No Added Choline Research Diets A06071302 Albumin, from Bovine Serum, Fraction V, pH7.0 Wako 013-27054 Polyoxyethylene(20) Sorbitan Monolaurate Wako 167-11515 Target Retrieval Solution Dako S1700 ISOGEN with Spin Column Nippon Gene 318-07511 iScript cDNA Synthesis Kit BioRad 170-8891 THUNDERBIRD SYBR qPCR MIX TOYOBO QPS-201 MVX100 Olympus DMi8 Leica T100 Thermal Cycler BioRad 1861096J1 StepOnePlus Applied Biosystems 01CP 1.9 Please provide the details of the corresponding methods author for the manuscript: Hayato Nakagawa Department of Gastroenterology, The University of Tokyo, 7-3-1 Bunkyo-ku Hongo, Tokyo, 113-8655 E-mail: hanakagawa-tky@umin.ac.jp Tel: +81-3-3815-5411; Fax: +81-3-3814-0021 2.0 Please confirm for randomised controlled trials all versions of the clinical protocol are included in the submission. ..
|
Jackson Immuno is a verified supplier 